ASSESSMENT OF INDOLEAMINE-2,3-DIOXYGENASE EXPRESSION BY MONONUCLEAR CELLS IN INDIVIDUALS INFECTED BY HEPATITIS B VIRUS IN ZARIA, NIGERIA

BY

AHMAD ABDURRAHMAN E.

 

UNDER THE MENTORSHIP OF

 

PROF. A. T. OLAYINKA

DEPARTMENT OF MEDICAL MICROBIOLOGY

AHMADU BELLO UNIVERSITY, ZARIA

 

DR. B. O. P. MUSA

DEPARTMENT OF MEDICINE

AHMADU BELLO UNIVERSITY, ZARIA

 

PROF. A. G. BAKARI

DEPARTMENT OF MEDICINE

AHMADU BELLO UNIVERSITY, ZARIA

1.0       Introduction

Hepatitis B virus (HBV) is one of the major causes of morbidity and mortality worldwide (Caley et al., 2012). Over 4 billion people worldwide are thought to have evidence of past or present infection with HBV, with about 350 million chronic carriers of HBV (Mulyanto et al., 2012; Shi, 2012). Worldwide, an estimate of 650,000 people die each year from the complications of chronic hepatitis B (CHB) (Lozano et al., 2012). In Nigeria, HBV infection is hyperendemic with the seroprevalence of HBsAg ranging from 10 – 40% (Fasola et al., 2008; Forbi et al., 2008; Bello et al., 2011; Ndako et al., 2014).

Recently 10 genotypes of HBV (A through J) have been identified on the basis of 8% difference in genome sequence, each with a distinctive geographical distribution (Tatematsu et. al., 2009; Hernández et. al., 2014; Majid et. al, 2016). In the Sub-Saharan Africa, genotypes E is said to predominate the region, followed by genotypes A and D (Odemuyiwa et al., 2001; Schaefer, 2007).

Indoleamine-2,3-dioxygenase (IDO) is an intracellular rate limiting enzyme that catabolizes tryptophan (Trp) to N-formylkynurinine through the kynurenine (Kyn) pathway (Mellor and Munn, 2004). It was suggested that expression of this enzyme by dendritic cells (DCs) and monocytes is regulated by different soluble and membrane-bound molecules such as interferon (IFN) –α and –β, tumor necrosis factor (TNF) –α and cytotoxic T lymphocyte antigen (CTLA)-4/CD28, among others (Favre et al., 2010). Indoleamine-2,3-dioxygenase is a major inhibitor of the immune response effector phase as it suppresses effector T cells by depleting Trp, an essential amino acid for the proliferation of the cell (Andersen, 2012). As Trp is depleted, effector T cells cannot proliferate and thus, go into G1 cell cycle arrest and hence the induction of tolerance which in turn, promotes sustenance of infectious diseases into chronic stage (Munn et al., 2005; Loughman and Hunstad 2012). Alternatively, the CD28 receptors on IDO⁺ DC bind to CTLA-4 on T_regs leading to their proliferation and subsequent induction of antigen specific anergy, thereby influencing T_regs suppressive activity (Prendergast et al., 2009). It was also recently shown that IDO may have a non-enzymatic function that contributes to tumor growth factor (TGF)-β driven tolerance in non-inflammatory process (Pallotta et al., 2011).

1.1       Statement of the Problem

Recent HBV seroprevalence studies in Nigeria show it is hyperendemic in the region. A prevalence rate of 13.6% was recorded by Musa et al., (2015) in their meta-analysis and systemic review, while Olayinka et al., (2016) recorded 12.2% in their national seroprevalence survey. Despite an appropriate T-cell response during the acute phase of HBV infection and subsequent viral clearance, the T-cells appear to respond weakly in chronic phase of the infection, promoting viral persistence (Schmidt and Schultze 2014). The cumulative immunosuppressive effects of IDO could be responsible for HBV persistence just as the HBV genotype, as factors that warrant the progression could be viral or host factors (Kao, 2002; Ramezani et al., 2012). Understanding these factors is an essential tool in preventing the progression of the infection to chronicity, with a resultant impact on the outcome of liver cancer. 

1.2       Justification to the Study

Progression of HBV infection to chronic phase is thought to be determined by both viral and host immunological factors (Ramezani et al., 2012). The most important viral factor implicated is the genotype of the HBV, while the host factors include such mechanisms that ensure the induction of tolerance that allows for viral persistence. Such mechanisms as IDO expression by antigen presenting cells (APCs) of the host together with HBV genotype variation need to be studied to identify possible basis for HBV persistence.

1.3       Aim

To determine Indoleamine-2,3-dioxygenase (IDO) expression by mononuclear cells in individuals infected by various genotypes of hepatitis B virus (HBV) in Zaria, Nigeria.

1.4       Specific Objectives

1. To compare mononuclear cell counts between the HBV infected individuals and the healthy controls in Zaria, Nigeria.
2. To identify the genotypes of HBV prevalent in Zaria, Nigeria.
3. To compare mononuclear cell counts in individuals with varying HBV genotypes in Zaria, Nigeria.
4. To determine differences in IDO expression by mononuclear cells in hepatitis B virus infected individuals and healthy controls in Zaria, Nigeria.
5. To determine differences in IDO expression by mononuclear cells in individuals infected by different genotypes of HBV in Zaria, Nigeria.

1.5       Research Hypothesis

H_o:       Indoleamine 2,3-deoxygenase expression does not influence progression of HBV to chronic stage in infected adults in Zaria.

H₁:       Indoleamine 2,3-deoxygenase expression influences progression of HBV to chronic stage in infected adults in Zaria.

2.0       Materials and Methods

2.1       Study Area

This study will be conducted in Zaria. Zaria is a major city in Kaduna State in Northern Nigeria, as well as being a Local Government Area. It has 11^o04’N 7^o42’E as coordinates, a total land area of 300km² and a population of 408,198, by 2006 census. The neighbourhoods surrounding Zaria city include Lowcost Kofar Gayan, Gwargwaje, Danmagaji/Wusasa, Tudun Wada, Kongo, PZ, Sabon Gari, GRA-Zaria, Hanwa, Bassawa, Samaru and Shika. Of these neighbourhoods, Samaru and Sabon Gari are predominantly occupied by the Nigerians of southern origin (Dan, 2010).

Zaria has one Tertiary/Teaching Hospital; Ahmadu Bello University Teaching Hospital (ABUTH) located in Shika, two General Hospitals; Hajiya Gambo Sawaba General Hospital and Limi Hospital in Kofar Gayan and Sabon Gari, respectively. Many other primary health institutions and private clinics are also spread across Zaria.

Study participants will be recruited and have their blood samples collected from the gastrointestinal tract (GIT) clinic of the Ahmadu Bello University Teaching Hospital Shika Zaria, Nigeria. The choice of the clinic is informed by the availability of clinical history of participants, from which their hepatitis clinical staging can be obtained.

2.2       Minimum Sample Size Determination

N = Z1-ɑ/22P(1-P)/d2

The minimum sample size was calculated using single proportion formula:

 

                                                                                                         ---------(Jaykaran, 2013)

Where:

N= Minimum sample size

Z_1-ɑ/2²= Standard Normal deviate set at 1.96.

P= Prevalence rate of 12.2% (0.122) was recorded according to Olayinka et al., 2016;

d= acceptable error of 5% (0.05)

Therefore, the minimum sample size was calculated to be 165.  

2.3       Study Participants

One hundred and sixty five (165) participants aged ≥18 years with chronic HBV infection will be recruited for the genotype prevalence study. From each of the identified genotype, 3 participants, along with 3 control participants, will then be recruited for collection of fresh blood samples for further analysis of IDO expression and mononuclear cells isolation. Participants confirmed to be negative for both HIV and HCV and positive for HBsAg for ≥6 months will be recruited. Those negative for HIV, HCV, HBsAg and HBcAb will be recruited as controls. The second set of controls will include those with acute HBV infection evident from positive reaction for HBsAg and HBcAb (IgM). 

2.4       Inclusion Criteria

The inclusion criteria for the study participants include:

• The participants should be ≥18 years of age;
• They should be negative for HIV and HCV;
• They should be positive for HBsAg for ≥6 months.

The selection criteria for the study controls include:

• The control volunteers should be ≥18 years of age;
• They should be negative for HIV, HCV, HBsAg and HBcAb.

2.5       Exclusion Criteria

Study participants or controls with any immunosuppressive illness such as HIV, or diabetes will be excluded from the study.  Also those who fail to give consent will also be excluded.

2.6       Study Design

This is a cross-sectional comparative study.

2.7       Sampling Technique

Purposive sampling technique will be employed in this study.

2.8       Ethical Considerations

Ethical approval will be obtained from the Health Research Ethics Committee (HREC) of the Ahmadu Bello University Teaching Hospital, Zaria Nigeria before commencement of sample collection. Informed consent will be sought for and obtained prior to enrollment into the study. Participants’ data will be treated with utmost confidentiality.    

2.9       Sample Collection

For the HBV genotyping 4mL of blood sample will be collected from each participant in plain tube. The blood will be allowed to stand at room temperature till it clots completely. The clotted blood will be centrifuged at 5000rpm for 5 minutes to separate the serum. The clear layer of serum will then be transferred into cryovials and stored at -70^oC till analysis. Five (5) mL of blood will be collected from each of the representatives of the test and control groups into EDTA tubes, for mononuclear cells isolation and IDO expression.      

2.10     Laboratories and Sample Transportation

Hepatitis B viral genotyping and IDO gene expression will be conducted in DNA LABS Kaduna, Nigeria; a privately owned reference laboratory for Nigerian center for disease control and prevention (NCDC) that specializes in Molecular Testing and Genetic Science. Sera will be separated from whole blood at the Immunology Laboratory of the ABUTH Zaria, where the PBMCs isolation will be conducted. The sera and the PBMCs suspension will be transported in cold chain to the point of testing and stored at -70^oC till analysis. Full blood count will be assayed in Haematology Laboratory of ABUTH Zaria.   

2.11     Samples Analyses

The analyses to be carried out include (i) HBV genotyping on serum samples, (ii) full blood count (FBC) on EDTA- anticoagulated blood, (iii) peripheral blood mononuclear cells (PBMCs) isolation from EDTA-anticoagulated blood, and (iv) assay of IDO expression by isolated mononuclear cells. The HBV genotyping will be carried out on the sera of all 165 chronically HBV-infected participants, while the other 3 analyses (ii) – (iv) will be conducted on the selected representatives of those infected with different HBV genotypes (3 from each genotype) and 3 controls. For budgeting and estimate purposes, five genotypes are hypothesized and predicted as the outcome of the genotyping analysis. Therefore,

n=5 x 3+3x2 ;

n=21 blood samples are hypothesized to be used for analyses (ii) – (iv).   

2.11.1  HBsAg, HBcAb, HCV and HIV Screening

The sera collected from the participants will be screened for hepatitis B surface antigen (HBsAg), hepatitis C virus (HCV) and human immunodeficiency virus (HIV). The HBsAg reactivity determines the placement of the participant into test group or control group. Those reactive for HBcAb (IgM) will be considered to have acute HBV infection and therefore will be recruited as control group II. Positive reactions with HIV and HCV disqualified the participant from participating in the study, in adherence to the exclusion criteria. 

2.11.2  Hepatitis B Virus Extraction and Amplification

According to Doumbia et al. (2013), nucleotide sequencing produces the most reliable HBV genotyping results, and will therefore be used for genotype analysis of those that could not yield genotype results by multiplex PCR in this study. Hepatitis B virus infection will be confirmed by rapid assay to detect HBsAg. Hepatitis B virus DNA will be extracted from sera of the HBsAg positive participants using EXiPrep^TM 16Dx Extraction machine (Bioneer Corporation, South Korea) with EXiPrep^TM Dx viral DNA extraction kit according to the manufacturer’s instructions.

Multiplex-nested PCR using type-specific primers will be used to assign genotypes A through F based on pre-S1 through S genes of the HBV genome. The design of the HBV genotype specific primers is based on the conserved regions of the sequences in a particular genotype and discordance in homology with the sequences of other HBV genotypes (Doumbia et al., 2013). Five such different sets of primers will be used: P₁ and S_1-2 being the universal outer primers and B2 will be used as the inner sense (forward) primer with a combination of BA1R, BB1R and BC1R as anti-sense (reverse) inner primers for genotypes A, B and C respectively, in a multiplex system tagged ‘Mixture A’. For genotypes D, E and F, an anti-sense primer B2R will be used in combination with BD1, BE1 and BF1 as sense (forward) primers, also in a multiplex system tagged ‘Mixture B’. List and classification of primers to be used are shown in Table 2.1.

Table 2.1: Sequences of Primers for HBV amplification and genotyping used by multiplex-nested PCR

Primer	Sequence (5’-3’)	Specificity	Position	Polarity
First Round
P1	TCACCATATTCTTGGGAACAAGA	Universal	2823-2845	Sense
S1-2	CGAACCACTGAACAAATGGC	Universal	685-704	Antisense
2nd Round: Mixture A
B2	GGCTCCAGTTCCGGAACAGT	Type A-E	67-86	Sense
BA1R	CTCGCGGAGATTGACGAGATGT	Type A	113-134	Antisense
BB1R	GGTCCTAGGAATCCTGATGTTG	Type B	165-186	Antisense
BC1R	CAGGTTGGTGAGCTGGAGA	Type C	2979-2996	Antisense
2nd Round: Mixture B
B2R	GGAGGCGGATTTGCTGGCAA	Type D-F	3078-3097	Antisense
BD1	GCCAACAAGGTAGGAGCT	Type D	2979-2996	Sense
BE1	CACCAGAAATCCAGATTGGGACCA	Type E	2955-2978	Sense
BF1	GTTACGGTCCAGGGTTACCA	Type F	3032-3051	Sense

 

 

The reaction volume for the first round of the nested PCR will be 40μl comprising of 27.8μl of DEPC-H₂O, 5.2μl of premix (premix of 250μM of each dNTP, 1X PCR buffer, 15mM of MgCl₂ and 1U of thermostable Taq polymerase), 5μl of the extracted HBV DNA and 1μl each of P₁ (forward) and S_1-2 (reverse) outer primers. The PCR will be performed using thermal cycler (PTC-100^TM Programmable thermal controller, MJ Research, Inc.) and reaction conditions will be: initial activation at 95ºC for 5 min; denaturation at 94ºC for 1 minute; annealing at 55ºC for 1 minute and extension at 72ºC for 2 minutes. Complete 40 cycles will be observed.

Hepatitis B Virus Genotyping

Two second round PCRs will be performed in two different tubes for each sample, one with the common universal sense primer (B2) and type specific primers for genotypes A, B, C in “Mixture A” and the other with the common universal anti-sense primer B2R and type specific primers for genotypes D, E, F in “Mix- B”. Reaction volumes of the second multiplexing PCR systems will contain 5μl of the extracted product, 1 μl of each primer, 1μl (10 mM) dNTP, 5X PCR buffer, 3 μl MgCl₂ and 1 μl of Taq DNA Polymerase. The cyclic parameters will be  94ºC for 5 min, followed by 20 cycles consisting of 94ºC for 20 s, 58ºC for 20 s and 72ºC for 30 s for “Mixture A” and 94ºC for 20 s, 58ºC for 20 s and 72ºC for 30 s for “Mixture B”.

Agarose Gel Electrophoresis

Fifty (50) µl of each sample will be run on 2% agarose gel (2% w/v in 1x TAE buffer) and electrophoresed in 1x TAE buffer for 45 minutes at 100V. Then it will be stained with Ethydium bromide. The size of the separated bands (DNA fragments) will be compared with GeneRuler^TM 50bp DNA ladder (MBI Fermentas, Life Sciences, Canada). The bands will be visualized under gel documentation system (BioRad Gel Doc-XR, USA) and screenshots captured. The bands of some selected (on different lanes from the gel will be excised under ultraviolet (UV) light and Qiagen’s Qiaquick purification kit (QIAGEN Sample & Assay Technologies, Germany) will be used to clean up the DNA for sequencing, according to manufacturer’s instructions. 

Hepatitis B Virus DNA Sequencing

Purified samples of selected genotypes will be analyzed by sequencing using the KY78 primer by sequencing machine (Beckman Coulter CEQ 2000XL). The chromatographs will be edited using FinchTV (version 1.4.0) software. Sequence alignments will be performed by online BLAST (basic local alignment search tool) analysis on http://www.blast.ncbi.nlm.nih.gov/Blast.cgi to arrive at specific genotypes.

2.11.3  Full Blood Count (FBC)

Full blood count using Sysmex (KX-21N) haematology analyzer will be performed on the EDTA-anticoagulated blood of HBV infected representatives and the controls in order to obtain the absolute counts of monocytes. Operation of the haematology analyzer will be according to manufacturer’s instructions. Monocytes (including DC and macrophages in circulation) and lymphocytes count will documented.

2.11.4  Mononuclear Cells Isolation

Mononuclear cells, also called Peripheral blood mononuclear cells are made up of all mononucleated cells (monocytes, lymphocytes and thrombocytes). Peripheral blood mononuclear cells (PBMCs) will be isolated from EDTA-anticoagulated blood samples of both selected participants and control volunteers by density gradient separation using Ficoll-Paque. The cells will be diluted 2 – 4x the volume of buffer. Carefully, 35mL of the diluted cell suspension will be layered over 15mL of Ficoll-Paque in s 50mL conical tube. The tube will then be centrifuged at 400xg for 30 minutes at 20^oC in a centrifuge with the brakes off. The upper layer will then be aspirated leaving the mononuclear cell layer undisturbed at the interphase. The mononuclear cell layer will then be carefully transferred to a new 50mL conical tube. The conical tube will then be filled with buffer, mixed and centrifuged at 300xg for 10 minutes at 20^oC to purify the cells. The supernatant will then be carefully removed completely. It will be purified in the same manner again only this time, at 200xg for 15 minutes and the thrombocytes will remain in the supernatant. The procedure is as described by the kit manufactures (Miltenyi Biotec, 2008).

2.11.5  Assay of IDO expression

Indoleamine-2,3-deoxygenase message RNA (IDO mRNA) levels will be assayed from isolated mononuclear cells by real-time polymerase chain reaction (qRT-PCR). Total RNA will be extracted from mononuclear cells suspension using EXiPrep^TM 16Dx Extraction machine (Bioneer Corporation, South Korea) with EXiPrep^TM Dx human RNA extraction kit according to the manufacturer’s instructions. The RNA will be converted to complementary DNA (cDNA) by reverse transcription at 42⁰C for 60 minutes.

Two sets of primers for IDO-1 and IDO-2 (Table 2.2) will be used for this analysis in the qRT-PCR with RotorGene thermocycler. Assay for IDO cDNA PCR will be performed with a final volume of 20µL comprising of 0.5µl of cDNA with 10pmol of the primers per reaction and fluorescence will be measured over 40 cycles.  The PCR products will be analysed further by a melt curve program from 55^oC to 95^oC with 5 seconds each, ending with 1minute at 95^oC.

 

 

Table 2.2: Indoleamine 2,3-deoxygenase (IDO)-1 and IDO-2 list of primers for IDO gene amplification using qRT-PCR

Primer	Sequence (5’-3’)
IDO-1, forward	GGC ACA CGC TAT GGA AAA CT
IDO-1, reverse	CGG ACA TCT CCA TGA CCT TT
IDO-2, forward	TGC TTC ATG CCT TTG ATG AG
IDO-2, reverse	GAA GGC CTT ATG GGA AGG AG

 

2.12     Data Management

The data will be collected and validated in Microsoft Excel® spreadsheet. It will be analyzed using GraphPad prism 6 statistical software package. Qualitative variables will be expressed as frequencies and percentages while quantitative variables will be presented as mean (±SD) or median (and ranges) as the case may be. For quantitative data that follow the Gaussian distribution, Student t-test will be used to compare the variables in test and control groups, while One-way ANOVA will be used to compare statistical differences among the variables in different genotypes of HBV if found to be more than two genotypes. If not normally distributed, Mann-Whitney U test will be used to compare statistical differences between two groups of variables, while Kruskal-Wallis will be applied on more than two groups such as the IDO gene expression in different groups with different HBV genotypes. Odds ratio and Chi-square tests for independence will be used to determine relationships for qualitative variables. Spearman’s correlation for non-parametric and Pearson’s correlation for normally distributed data will be used to determine correlations between mononuclear cell counts and IDO expression. The significance level will be set at p<0.05 with 95% confidence interval.    

References

Andersen, M.H. (2012). The specific targeting of immune regulation: T-cell responses against Indoleamine 2,3-dioxygenase. Cancer Immunology, Immunotherapy, 61:1289 – 1297.

Bello, R.H., Obot, E. and Olabode H.O.K. (2011). Sero-prevalence and risk factors associated with hepatitis B surface antigen (HBsAg) amongst patients in Biu, Borno state, Nigeria. Journal of Public Health and Epidemiology, 3(10):448 – 453.

Caley, M., Fowler, T., Greatrex, S. and Wood,  A. (2012). Differences in hepatitis B infection rate between ethnic groups in antenatal women in Birmingham, United Kingdom, May 2004 to December 2008. Euro Surveillance : Bulletin Européen Sur Les Maladies Transmissibles = European Communicable Disease Bulletin, 17(30), 1–6. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/22856511

Dan I. (2010). Nigeria’s emirs: Power behind the throne. BBC News. Retrieved 2010-09-29. Available on (http://www.bbc.co.uk/news/world-africa-11418542).

Doumbia, M., Kouassi, M. A., Kakou, N. S. and Sevede D. (2013). Molecular characterization of hepatitis B virus isolated from two groups of patients at risk in Côte d’Ivoire. Journal of Microbiology Research and Reviews, 1(5):61 – 66.

Fasola, F.A., Kotila, T.R. and Akinyemi, J.O. (2008). Trends in transfusion-transmitted viral infections from 2001 to 2006 in Ibadan, Nigeria. Intervirology 51: 427–431.

Favre, D., Mold, J., Hunt, P.W., Kanwar, B., Loke, P., Seu, L., … and McCune, J. M. (2010). Tryptophan catabolism by indolamine 2,3-dioxygenase 1 alters the balance of TH17 to regulatory T cells in HIV disease. Science Translational Medicine, 2:32ra6. 

Forbi, J.C., Onyemauwa, N., Gyar, S.D., Oyeleye, A.O., Entonu, P. and Agwale S.M. (2008). High prevalence of hepatitis B virus among female sex workers in Nigeria. Revista do Instituto de Medicina Tropical de Sao Paulo, 50: 219–221.

Hernández, S., Venegas, M., Brahm, J., Villanueva, R.A. (2014). Full-genome sequence of a hepatitis B virus genotype f1b clone from a chronically infected Chilean patient (2014). Genome Announcement. 2(5):e01075–14. doi:10.1128/genomeA.01075-14.

Jaykaran, C. and Tamoghna, B. (2013). How to calculate sample size for different study designs in medical research. Indian Journal of Psychological Medicine, 35(2): 121 – 126.

Kao, J.H. (2002). Hepatitis B viral genotypes: clinical relevance and molecular characteristics. Journal of Gastroenterology and Hepatology, 17(6):643-650.

Loughman, J.A. and Hunstad, D.A. (2012). Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Journal of Infectious Diseases, 205:1830–9. doi:10.1093/infdis/jis280

Lozano, R., Naghavi, M., Foreman, K., Lim, S., Shibuya, K., Aboyans, V, … and Memish, Z. A. (2012). Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet, 380(9859):2095–128.

Majid, M., Muhammad, A. A., Azra, K., Nasib, Z. and Abida, R. (2016). Distribution and clinical significance of hepatitis B virus genotypes in Pakistan. BMC Gastroenterology, 16:1-9.

Mellor, A.L. and Munn, D.H. (2004). IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nature Review Immunology, 4:762 - 74.

Miltenyi Bitech (2008). Isolation of mononuclear cells from human peripheral blood by density gradient centrifugation. Available on www.miltenyibiotech.com. Accessed on 27^th July, 2016.

Mulyanto, P.P., Depanmede, S.N., Wahyono, A., Jirintai, S., Nagashima, S., Takahashi, M., … and Okamoto, H. (2012): Identification of four novel subgenotypes (C13-C16) and two inter-genotypic recombinants (C12/G and C13/B3) of hepatitis B virus in Papua province, Indonesia. Virus Research, 163:129–140.

Munn, D.H., Sharma, M.D., Baban, B., Harding, H.P., Zhang, Y., Ron, D. and Mellor, A.L. (2005). GCN2 kinase in T cells mediates proliferative arrest and anergy induction in response to indoleamine 2,3- dioxygenase. Immunity, 22(5):633–642.

Musa, B. M., Bussell, S., Borodo, M. M., Samaila, A. A. and Femi, O. L. (2015). Prevalence of hepatitis B virus infection in Nigeria, 2000-2013: A systematic review and meta-analysis. Nigerian Journal of Clinical Practice, 18(2), 163–172.

Ndako, J.A., Onwuliri, E.A., Adelani-Akande, T., Olaolu, D.T., Dahunsi, S.O. and Udo, U.D. (2014). Screening for Hepatitis B surface antigen (HBsAg) among health care workers (HCW) in an urban community South-South Nigeria. International Journal of Biology, Pharmacy and Allied Sciences, 3(3):415 – 425.  

Odemuyiwa, S.O., Mulders, M.N., Oyedele, O.I., Ola S. O., Odaibo, G. N., Olaleya, D. O. and Muller, C. P. (2001). Phylogenetic analysis of new hepatitis B virus isolates from Nigeria supports endemicity of genotype E in West Africa. Journal of Medical Virology, 65:463–9. Doi: 10.1002/jmv.2058

Olayinka A. T., Oyemakinde, A, Balogun, M. S., Ajudua, A., Nguku, P., Aderinola, M., … and Nasidi, A. (2016). Seroprevalence of hepatitis B infection in Nigeria: A national survey. American Journal of Tropical Medicine and Hygiene, 15 – 0874 (Published online August 15, 2016). DOI: 10.4269/ajtmh.15-0874. Accessed on 18^th August, 2016.

Pallotta, M.T., Orabona, C., Volpi, C., Vacca, C., Belladonna, M.L., Bianchi, R., … and Grohmann, U. (2011). Indoleamine 2,3-dioxygenase is a signaling protein in long-term tolerance by dendritic cells. Nature Immunology 12(9):870–878.

Prendergast, G.C., Metz, R. and Muller, A.J. (2009). IDO recruits Tregs in melanoma. Cell Cycle, 8(12):1818–1819.

Ramezani, A., Banifazl, M., Mamishi, S., Sofian, M., Eslamifar, A. and Aghakhani, A. (2012). The influence of human leukocyte antigen and IL-10 gene polymorphisms on hepatitis B virus outcome. Hepatitis Monthly, 12(5):320 – 5.

Schaefer, S. (2007). Hepatitis B virus taxonomy and hepatitis B virus genotypes. World Journal of Gastroenterology, 13(1):14-21.

Schmidt, S.V. and Schultze, J.L. (2014). New insights into IDO biology in bacterial and viral infections. Frontiers in immunology, 5(384):1-12.

Shi, Y.H. (2012). Correlation between hepatitis B virus genotypes and clinical outcomes. Japanese Journal of Infectious Diseases, 65(6):476-482.

Tatematsu, K., Tanaka, Y., Kurbanov, F., Sugauchi, F., Mano, S., Maeshiro, T., … and Mizokami, M. (2009). A genetic variant of hepatitis B virus divergent from known human and ape genotypes isolated from a Japanese patient and provisionally assigned to new genotype J. Journal of Virology, 83:10538–10547.

Appendix I

Questionnaire

TEST [  ]                    CONTROL A [  ]                  CONTROL B [  ]

Date:__________________________

Questionnaire serial No.:__________

Participants serial No.:___________

SECTION A: TO BE FILLED BY THE PARTICIPANT

1.         Age [      ]       

2.         Sex  [ m ]         [ f ]

3.         Marital status:             Married [ ]       Single [  ]         divorced [  ]

4.         No. of sexual partners: 1[  ]                2[  ]                  3[  ]                  4[  ]      >4 [  ]

5.         Address:_________________________________________________________

6.         Phone No._______________________, alternative no._____________________

7.         Next of kin phone No.:_________________________

8.         Level of Education:    Primary [  ]                  Secondary [  ]              Tertiary [  ]

            Qur’anic/Islamiyya only [  ]                None [  ]

9.         Occupation:_____________________________________

10.       When were you diagnosed with hepatitis B virus?   

<6 months ago [  ]                   ≥6 months ago [  ]       I don’t know [  ]

11.       Is there any other disease or infection that you have (e.g. diabetes)?

            Yes [  ]            No [  ]

12.       If yes, specify______________________________________________

 

SECTION B: TO BE FILLED IN THE LAB

Laboratory Screening Results

            HBsAg            Positive [   ]                 Negative [   ]

            HBcAb            Positive [   ]                 Negative [   ]

            HCV               Positive [   ]                 Negative [   ]

            HIV                 Positive [   ]                 Negative [   ]

Laboratory Results

HBV genotype:           A [  ]                B [  ]                C [  ]

D [  ]                E [  ]                F [  ]

G [  ]                H [  ]                I [  ]

Full blood count (FBC):

Total WBC:______

Total lymphocytes:__________

Total monocytes:___________

RBCs_________________

PCV__________________

Hb Conc.:_____________

Kyn/Trp ratio:_________                               IDO (copies/mL):___________________

 

Appendix II

Informed Consent Form

My name is AHMAD, Abdurrahman. I am a PhD student of Immunology in the Department of Medicine, Ahmadu Bello University, Zaria. I intend to carry out a study on Determination of Indoleamine-2,3-Dioxygenase Expression by Mononuclear Cells in Individuals Infected by Various Genotypes of Hepatitis B Virus in Zaria, Nigeria.

The study will involve you being asked some questions. During the course of this exercise, your venous blood sample will be taken and you may be recalled for another venous blood sample collection. This will cause a little discomfort but with no harm.

The blood taken will be tested for the type of hepatitis B virus that you have circulating in you. If recalled for the second time for another blood sample, that sample will be used to investigate further for other substances that your body produce in response to the viral challenge. Please note that your responses and test results will be kept strictly confidential.

The final findings of this study will highlight to us why the virus is still in you while the immune system is supposed to clear it.

The tests will be done free-of-charge. I appreciate your help and participation in this study.

PARTICIPANT’S AFFIRMATION

This study has been explained to me well and I fully understand what it entails. I am also aware that I may withdraw at any time I so wish. I am willing to participate in the study.

 

__________________________                                ___________________________     

Participant Sign/Thumbprint/Date                              Investigator Sign/Thumbprint/Date

 

 

_________________________

Witness Sign/Thumbprint/Date